Stem-loop sequence bta-mir-453

AccessionMI0009839 (change log)
DescriptionBos taurus miR-453 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ---------------     aa      ca     a  g    a  g 
5'                gcggg  cgccac  gcagc cu ccuc cg u
                  |||||  ||||||  ||||| || |||| || a
3'                cgcuu  guggug  uguug ga ggag gu c
   cguaguaauuuauua     ga      cc     -  g    -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67873059-67873138 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-453
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
Database links

Mature sequence bta-miR-453

Accession MIMAT0009325
Sequence

44 - 

agguuguccguggugaguucgca

 - 66

Get sequence
Evidence by similarity; MI0001727
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).