Stem-loop sequence bta-mir-452

AccessionMI0009838 (change log)
DescriptionBos taurus miR-452 stem-loop
Gene family MIPF0000287; mir-452
Literature search

1 open access papers mention bta-mir-452
(1 sentences)

Stem-loop
     u          aac g        g  a       cu ug 
5' gc aagcacuuac   u uuugcaga ga acugaga  u  u
   || ||||||||||   | |||||||| || |||||||  |  a
3' cg uucgugaaug   a aaacgucu cu ugacucu  a  a
     u          --a g        a  c       au uc 
Get sequence
Deep sequencing
20139 reads, 60.6 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 34882394-34882478 [-]
sense
ENSBTAT00000065531 ; GABRE-201; intron 6
ENSBTAT00000018017 ; GABRE-202; intron 6
Clustered miRNAs
< 10kb from bta-mir-452
bta-mir-452chrX: 34882394-34882478 [-]
bta-mir-224chrX: 34881360-34881440 [-]
bta-mir-3431chrX: 34879430-34879526 [-]
Database links

Mature sequence bta-miR-452

Accession MIMAT0009324
Sequence

17 - 

uguuugcagaggaaacugagac

 - 38

Get sequence
Deep sequencing19196 reads, 66 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).