Stem-loop sequence bta-mir-448

AccessionMI0009833 (change log)
DescriptionBos taurus miR-448 stem-loop
Gene family MIPF0000149; mir-448
Literature search

1 open access papers mention bta-mir-448
(3 sentences)

Stem-loop
   ----------gc        u a            g   u     ga       a   ua 
5'             ggggaggu g acauccugcaua ugc gccag  aaucccu uuu  u
               |||||||| | |||||||||||| ||| |||||  ||||||| |||   
3'             ccccucua c uguaggauguau acg ugguc  uuggggg gaa  a
   cuacuacaccca        c c            -   u     gg       g   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 68837562-68837672 [+]
intergenic
Database links

Mature sequence bta-miR-448

Accession MIMAT0009319
Sequence

72 - 

uugcauauguaggaugucccau

 - 93

Get sequence
Evidence by similarity; MI0001640
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).