Stem-loop sequence bta-mir-433

AccessionMI0009832 (change log)
DescriptionBos taurus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

3 open access papers mention bta-mir-433
(92 sentences)

Stem-loop
   ------------------------uggccgg      gua   u          uuguucagagaggcuagau 
5'                                ggagaa   cgg gagccuguca                   c
                                  ||||||   ||| ||||||||||                    
3'                                ccucuu   gcu cucggguagu                   c
   cccgacggaaguaccacaccacggcgaugga      gug   c          acuaggaagaguuguuccu 
Get sequence
Deep sequencing
268 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67707406-67707529 [+]
antisense
ENSBTAT00000065107 ; bta-mir-433-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-433
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-433

Accession MIMAT0009318
Sequence

67 - 

aucaugaugggcuccucggugu

 - 88

Get sequence
Deep sequencing263 reads, 52 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).