Stem-loop sequence bta-mir-432

AccessionMI0009831 (change log)
DescriptionBos taurus miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

6 open access papers mention bta-mir-432
(16 sentences)

Stem-loop
   gcaugacuccu     u u     ua       g     a   uu   uu 
5'            ccaag c uggag  ggucauu ggugg ucc  uau  c
              ||||| | |||||  ||||||| ||||| |||  |||   
3'            gguuc g accuc  ucgguag ucacc ggg  gua  c
   ---------gc     u u     -c       g     -   -u   uc 
Get sequence
Deep sequencing
7153 reads, 1.56 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67709994-67710083 [+]
antisense
ENSBTAT00000065107 ; bta-mir-433-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-432
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-432

Accession MIMAT0009317
Sequence

17 - 

ucuuggaguaggucauugggugg

 - 39

Get sequence
Deep sequencing7122 reads, 64 experiments
Evidence by similarity; MI0010403
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).