Stem-loop sequence bta-mir-431

AccessionMI0009830 (change log)
DescriptionBos taurus miR-431 stem-loop
Gene family MIPF0000142; mir-431
Literature search

4 open access papers mention bta-mir-431
(4 sentences)

Stem-loop
   -----------------------------------------------------------------------u     ---   u        g 
5'                                                                         ccugc   gcg ccugcgag u
                                                                           |||||   ||| ||||||||  
3'                                                                         ggacg   ugc ggacguuc g
   gcagcucccacuacuuauacagcagaacgcucuucgggacguucugcuggacguugcaaaggcagucacacc     uac   c        u 
Get sequence
Deep sequencing
356 reads, 0 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67706530-67706643 [+]
antisense
ENSBTAT00000065107 ; bta-mir-433-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-431
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-431

Accession MIMAT0009316
Sequence

20 - 

ugucuugcaggccgucaugcagg

 - 42

Get sequence
Deep sequencing158 reads, 50 experiments
Evidence by similarity; MI0001722
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).