Stem-loop sequence bta-mir-421

AccessionMI0009828 (change log)
DescriptionBos taurus miR-421 stem-loop
Gene family MIPF0000098; mir-95
Literature search

3 open access papers mention bta-mir-421
(3 sentences)

Stem-loop
   ----g    uu      -    uua            a   aaa 
5'      caca  guaggc cuca   aauguuuguuga uga   a
        ||||  |||||| ||||   |||||||||||| |||   a
3'      gugu  cguccg gggu   uuacagacaacu acu   u
   cucua    cu      c    uaa            -   aag 
Get sequence
Deep sequencing
11779 reads, 33.8 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 82990081-82990165 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-421
bta-mir-374bchrX: 82989913-82990007 [+]
bta-mir-421chrX: 82990081-82990165 [+]
Database links

Mature sequence bta-miR-421

Accession MIMAT0009314
Sequence

48 - 

aucaacagacauuaauugggcgc

 - 70

Get sequence
Deep sequencing11715 reads, 74 experiments
Evidence by similarity; MI0003685
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).