Stem-loop sequence bta-mir-412

AccessionMI0009827 (change log)
DescriptionBos taurus miR-412 stem-loop
Gene family MIPF0000192; mir-412
Literature search

2 open access papers mention bta-mir-412
(2 sentences)

Stem-loop
   ----cug      a      a    c      u   aa    -    u 
5'        ggguac ggacgg uggu gaccag ugg  agua auug u
          |||||| |||||| |||| |||||| |||  |||| ||||  
3'        cccaug ccuguc auca cugguc acu  ucau uaau u
   gacguca      -      g    c      c   --    g    c 
Get sequence
Deep sequencing
1002 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67881761-67881850 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-412
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-412

Accession MIMAT0009313
Sequence

53 - 

acuucaccugguccacuagcugu

 - 75

Get sequence
Deep sequencing39 reads, 28 experiments
Evidence by similarity; MI0002464
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).