Stem-loop sequence bta-mir-411a

AccessionMI0009826 (change log)
Previous IDsbta-mir-411
DescriptionBos taurus miR-411 stem-loop
Gene family MIPF0000126; mir-379
Literature search

2 open access papers mention bta-mir-411a
(2 sentences)

Stem-loop
   u      ug   a a    a      a a       - uuu 
5'  gguacu  gag g uagu gaccgu u gcguacg c   a
    ||||||  ||| | |||| |||||| | ||||||| |   u
3'  cuauga  cuc c auca cuggca a uguaugc g   c
   a      --   c a    c      c a       a ugu 
Get sequence
Deep sequencing
297625 reads, 2.58e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67841471-67841552 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-411a
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
Database links

Mature sequence bta-miR-411a

Accession MIMAT0009312
Previous IDsbta-miR-411
Sequence

15 - 

auaguagaccguauagcguacg

 - 36

Get sequence
Deep sequencing294237 reads, 65 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).