Stem-loop sequence bta-mir-409a

AccessionMI0009824 (change log)
Previous IDsbta-mir-409
DescriptionBos taurus miR-409a stem-loop
Gene family MIPF0000018; mir-154
Literature search

4 open access papers mention bta-mir-409a
(8 sentences)

Stem-loop
   u     g  gg   a    ac         -    - auc 
5'  gguac cg  gag gguu  ccgagcaac uuug c   u
    ||||| ||  ||| ||||  ||||||||| |||| |    
3'  cuaug gc  uuc ccaa  ggcucguug aagc g   g
   a     -  uu   c    gu         u    a cag 
Get sequence
Deep sequencing
38014 reads, 283 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67881619-67881697 [+]
sense
ENSBTAT00000042340 ; bta-mir-409b-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-409a
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-656chr21: 67883062-67883140 [+]
Database links

Mature sequence bta-miR-409a

Accession MIMAT0009310
Previous IDsbta-miR-409
Sequence

15 - 

agguuacccgagcaacuuugcau

 - 37

Get sequence
Deep sequencing815 reads, 52 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).