Stem-loop sequence bta-mir-383

AccessionMI0009823 (change log)
DescriptionBos taurus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

2 open access papers mention bta-mir-383
(12 sentences)

Stem-loop
      -c  a      aa    a        --    gu 
5' cuc  uc gaucag  ggug uuguggcu  uugg  g
   |||  || ||||||  |||| ||||||||  ||||  g
3' gag  ag cugguc  ucac gacaccga  aacu  a
      aa  a      cg    -        cu    au 
Get sequence
Deep sequencing
277 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 21444823-21444895 [+]
intergenic
Database links

Mature sequence bta-miR-383

Accession MIMAT0009309
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Deep sequencing265 reads, 50 experiments
Evidence by similarity; MI0000791
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).