Stem-loop sequence bta-mir-379

AccessionMI0009820 (change log)
DescriptionBos taurus miR-379 stem-loop
Gene family MIPF0000126; mir-379
Literature search

6 open access papers mention bta-mir-379
(11 sentences)

Stem-loop
   u  uuc   c    a    a       ga       - uuugu 
5'  gg   cug agag uggu gacuaug  acguagg c     g
    ||   ||| |||| |||| |||||||  ||||||| |      
3'  cc   gac ucuc auca cugguac  uguaucc g     a
   a  uau   -    a    c       aa       a uuuuu 
Get sequence
Deep sequencing
6714 reads, 1.59 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67840242-67840327 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-379
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
Database links

Mature sequence bta-miR-379

Accession MIMAT0009306
Sequence

16 - 

ugguagacuauggaacguagg

 - 36

Get sequence
Deep sequencing3212 reads, 63 experiments
Evidence by similarity; MI0003541
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).