Stem-loop sequence bta-mir-378-1

AccessionMI0009819 (change log)
Previous IDsbta-mir-378
DescriptionBos taurus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Literature search

24 open access papers mention bta-mir-378-1
(100 sentences)

Stem-loop
      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   c
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 
Get sequence
Deep sequencing
831095 reads, 6.49e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 63343197-63343262 [+]
intergenic
Database links

Mature sequence bta-miR-378

Accession MIMAT0009305
Sequence

43 - 

acuggacuuggagucagaaggc

 - 64

Get sequence
Deep sequencing1654631 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).