Stem-loop sequence bta-mir-374b

AccessionMI0009816 (change log)
DescriptionBos taurus miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

8 open access papers mention bta-mir-374b
(16 sentences)

Stem-loop
   gaa  aau  ---u  u    ug au             c       c 
5'    ga   cc    ac cgga  g  auaauacaaccug uaagugu c
      ||   ||    || ||||  |  ||||||||||||| |||||||  
3'    cu   gg    ug gccu  u  uauuauguuggac auucacg u
   cug  cuc  uauc  u    gu ac             u       a 
Get sequence
Deep sequencing
11953 reads, 81.1 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 82989913-82990007 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-374b
bta-mir-374bchrX: 82989913-82990007 [+]
bta-mir-421chrX: 82990081-82990165 [+]
Database links

Mature sequence bta-miR-374b

Accession MIMAT0009302
Sequence

22 - 

auauaauacaaccugcuaagug

 - 43

Get sequence
Deep sequencing4754 reads, 73 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).