Stem-loop sequence bta-mir-371

AccessionMI0009815 (change log)
DescriptionBos taurus miR-371 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
        u  gg        cu    g         g     
5' cagcc gu  uacucaaa  gugg ggcacuucc uuuu 
   ||||| ||  ||||||||  |||| ||||||||| ||| a
3' guugg ca  gugaguuu  uacc ccgugaagg aagc 
        c  uu        ug    g         g     
Get sequence
Deep sequencing
16 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 61434710-61434788 [-]
intergenic
Database links

Mature sequence bta-miR-371

Accession MIMAT0009301
Sequence

48 - 

aagugccgccauguuuugagugu

 - 70

Get sequence
Evidence experimental; Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).