Stem-loop sequence bta-mir-370

AccessionMI0009814 (change log)
DescriptionBos taurus miR-370 stem-loop
Gene family MIPF0000167; mir-370
Literature search

6 open access papers mention bta-mir-370
(19 sentences)

Stem-loop
         agaa       ca gu   u    uua   -  c 
5' aggcag    gccaggu  c  cuc gcag   cac cg u
   ||||||    |||||||  |  ||| ||||   ||| ||  
3' ucuguc    uggucca  g  ggg cguc   gug gc c
         ----       ag ug   u    --c   a  a 
Get sequence
Deep sequencing
422 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67735997-67736071 [+]
intergenic
Database links

Mature sequence bta-miR-370

Accession MIMAT0009300
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing380 reads, 59 experiments
Evidence by similarity; MI0000778
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).