Stem-loop sequence bta-mir-362

AccessionMI0009811 (change log)
DescriptionBos taurus miR-362 stem-loop
Gene family MIPF0000209; mir-362
Literature search

4 open access papers mention bta-mir-362
(5 sentences)

Stem-loop
   cuc           acc        -a ug     
5'    gaauccuugga   uaggugug  g  cugu 
      |||||||||||   ||||||||  |  ||| u
3'    cuuaggaacuu   auccacac  c  gauc 
   aaa           ---        aa gu     
Get sequence
Deep sequencing
938 reads, 20.3 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 93947354-93947418 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-362
bta-mir-502a-2chrX: 93942730-93942819 [+]
bta-mir-502bchrX: 93946864-93946946 [+]
bta-mir-362chrX: 93947354-93947418 [+]
bta-mir-500chrX: 93948610-93948693 [+]
bta-mir-660chrX: 93950762-93950841 [+]
bta-mir-502a-1chrX: 93952708-93952792 [+]
Database links

Mature sequence bta-miR-362-5p

Accession MIMAT0009298
Previous IDsbta-miR-362
Sequence

5 - 

aauccuuggaaccuaggugugagu

 - 28

Get sequence
Deep sequencing705 reads, 73 experiments
Evidence experimental; cloned [4]
Predicted targets

Mature sequence bta-miR-362-3p

Accession MIMAT0012548
Sequence

42 - 

aacacaccuauucaaggauuc

 - 62

Get sequence
Deep sequencing233 reads, 64 experiments
Evidence experimental; cloned [3-4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).