Stem-loop sequence bta-mir-346

AccessionMI0009810 (change log)
DescriptionBos taurus miR-346 stem-loop
Gene family MIPF0000188; mir-346
Literature search

1 open access papers mention bta-mir-346
(1 sentences)

Stem-loop
   -g u      g ug    u    cu    -  aug        u  guug 
5'   g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
     | |||||| |  |||| ||||  |||| ||   |||||||| ||     
3'   c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
   gg -      - gu    c    uu    u  --g        -  aguc 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 41491751-41491845 [-]
intergenic
Database links

Mature sequence bta-miR-346

Accession MIMAT0009297
Sequence

20 - 

ugucugcccgcaugccugccucu

 - 42

Get sequence
Deep sequencing41 reads, 13 experiments
Evidence by similarity; MI0000826
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).