Stem-loop sequence bta-mir-340

AccessionMI0009809 (change log)
DescriptionBos taurus miR-340 stem-loop
Gene family MIPF0000191; mir-340
Literature search

2 open access papers mention bta-mir-340
(4 sentences)

Stem-loop
   --uu     u      au       -caa      u    g     ug 
5'     guacc ggugug  uauaaag    ugagac gauu ucaug  u
       ||||| ||||||  |||||||    |||||| |||| |||||  c
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
23581 reads, 211 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 1160917-1161011 [+]
sense
ENSBTAT00000006384 ; RNF130-201; intron 3
Database links

Mature sequence bta-miR-340

Accession MIMAT0009296
Sequence

58 - 

uccgucucaguuacuuuauagcc

 - 80

Get sequence
Deep sequencing380 reads, 67 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).