Stem-loop sequence bta-mir-33b

AccessionMI0009808 (change log)
DescriptionBos taurus miR-33b stem-loop
Gene family MIPF0000070; mir-33
Literature search

15 open access papers mention bta-mir-33b
(27 sentences)

Stem-loop
   ---------gcggg    c   c  -          uu         g  u 
5'               cggc ccg gg ugcauugcug  gcauugcau ug g
                 |||| ||| || ||||||||||  ||||||||| || a
3'               gccg ggc cc acgugacggc  cgugacgug ac g
   cgccacgguccccg    a   -  g          uc         g  g 
Get sequence
Deep sequencing
1507 reads, 24.3 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 35416499-35416592 [+]
sense
ENSBTAT00000010372 ; SREBF1-201; intron 16
Database links

Mature sequence bta-miR-33b

Accession MIMAT0009295
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing1464 reads, 73 experiments
Evidence by similarity; MI0003646
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).