Stem-loop sequence bta-mir-339a

AccessionMI0009806 (change log)
Previous IDsbta-mir-339
DescriptionBos taurus miR-339 stem-loop
Gene family MIPF0000193; mir-339
Literature search

5 open access papers mention bta-mir-339a
(20 sentences)

Stem-loop
   ggg    c   u u c   u    c      u   uu  u 
5'    gcag cgc g c cug ccuc aggagc cac  gg c
      |||| ||| | | ||| |||| |||||| |||  || c
3'    cguc gug c g gac ggag uccucg gug  cc g
   ---    u   c c a   c    c      c   --  g 
Get sequence
Deep sequencing
24194 reads, 309 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 42489153-42489230 [+]
sense
ENSBTAT00000043431 ; C25H7ORF50-201; intron 1
Database links

Mature sequence bta-miR-339a

Accession MIMAT0009293
Previous IDsbta-miR-339
Sequence

14 - 

ucccuguccuccaggagcucac

 - 35

Get sequence
Deep sequencing23892 reads, 77 experiments
Evidence experimental; Array [3], qRT-PCR [3], cloned [4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).