Stem-loop sequence bta-mir-335

AccessionMI0009804 (change log)
DescriptionBos taurus miR-335 stem-loop
Gene family MIPF0000196; mir-335
Literature search

11 open access papers mention bta-mir-335
(37 sentences)

Stem-loop
   ----------uuu    c        a         c        u  gu 
5'              uggg ggggguca gagcaauaa gaaaaaug uu  c
                |||| |||||||| ||||||||| |||||||| ||   
3'              acuc ccuccagu cucguuauu cuuuuugc aa  a
   acucaugucguuu    u        c         a        c  au 
Get sequence
Deep sequencing
11034 reads, 18.8 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 95385649-95385740 [+]
sense
ENSBTAT00000044831 ; MEST-201; intron 2
Database links

Mature sequence bta-miR-335

Accession MIMAT0009291
Sequence

14 - 

ucaagagcaauaacgaaaaaugu

 - 36

Get sequence
Deep sequencing4905 reads, 64 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3