Stem-loop sequence bta-mir-329b

AccessionMI0009802 (change log)
DescriptionBos taurus miR-329b stem-loop
Gene family MIPF0000110; mir-329
Literature search

3 open access papers mention bta-mir-329b
(4 sentences)

Stem-loop
   -      cu           uu ug   uuc      u  aa 
5'  ugguac  gaagagagguu  c  ggu   uguuuc uu  u
    ||||||  |||||||||||  |  |||   |||||| ||   
3'  acuaug  cuuuucuccaa  g  cca   acaaag ag  g
   a      ac           uu gu   --c      u  ga 
Get sequence
Deep sequencing
243 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67844880-67844962 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-329b
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
Database links

Mature sequence bta-miR-329b

Accession MIMAT0009289
Sequence

13 - 

agagguuuucuggguuucuguuu

 - 35

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).