Stem-loop sequence bta-mir-329a

AccessionMI0009801 (change log)
DescriptionBos taurus miR-329a stem-loop
Gene family MIPF0000110; mir-329
Literature search

3 open access papers mention bta-mir-329a
(3 sentences)

Stem-loop
   g       u           uu      cuc      u   a 
5'  ugguacu gaggagagguu  cuaggu   uguuuc uuc u
    ||||||| |||||||||||  ||||||   |||||| |||  
3'  acuauga cuuuuuuccaa  ggucca   acaaag agg g
   -       c           uu      --c      u   a 
Get sequence
Deep sequencing
249 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67845190-67845272 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-329a
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
Database links

Mature sequence bta-miR-329a

Accession MIMAT0009288
Sequence

52 - 

aacacaccugguuaaccuuuuu

 - 73

Get sequence
Deep sequencing213 reads, 53 experiments
Evidence by similarity; MI0010398
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).