Stem-loop sequence bta-mir-328

AccessionMI0009800 (change log)
DescriptionBos taurus miR-328 stem-loop
Gene family MIPF0000203; mir-328
Literature search

2 open access papers mention bta-mir-328
(4 sentences)

Stem-loop
   cuguuuc     cu  ag           ga     u     a a    g 
5'        ggagc  gg  cgggggggcag  ggggc caggg g uagu u
          |||||  ||  |||||||||||  ||||| ||||| | ||||  
3'        ccuug  cc  gccuucccguc  ucccg guccc c gucg g
   -------     uc  cu           uc     -     - -    u 
Get sequence
Deep sequencing
1308 reads, 4.29 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 35062240-35062331 [-]
antisense
ENSBTAT00000001696 ; ELMO3-201; 3'UTR (exon 14)
Database links

Mature sequence bta-miR-328

Accession MIMAT0009287
Sequence

61 - 

cuggcccucucugcccuuccgu

 - 82

Get sequence
Deep sequencing1292 reads, 70 experiments
Evidence by similarity; MI0000603
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).