Stem-loop sequence bta-mir-326

AccessionMI0009799 (change log)
DescriptionBos taurus miR-326 stem-loop
Gene family MIPF0000143; mir-326
Literature search

1 open access papers mention bta-mir-326
(1 sentences)

Stem-loop
   cuc        g            c       uugu  a    gg   u 
5'    gucugucu uugggcuggagg agggccu    ga ggcg  uug g
      |||||||| |||||||||||| |||||||    || ||||  |||  
3'    uaggcgga gacccgaccucc ucccggg    cu ccgc  gac c
   acu        -            u       ---u  -    ua   u 
Get sequence
Deep sequencing
3264 reads, 4.35 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 55587182-55587276 [-]
sense
ENSBTAT00000027296 ; ARRB1-202; intron 1
Database links

Mature sequence bta-miR-326

Accession MIMAT0009286
Sequence

60 - 

ccucugggcccuuccuccag

 - 79

Get sequence
Deep sequencing3242 reads, 67 experiments
Evidence by similarity; MI0000808
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).