Stem-loop sequence bta-mir-324

AccessionMI0009798 (change log)
DescriptionBos taurus miR-324 stem-loop
Gene family MIPF0000165; mir-324
Literature search

2 open access papers mention bta-mir-324
(5 sentences)

Stem-loop
   aacu      gc     c   u c   a     u   u  aaag 
5'     ggcuau  cuccc gca c ccu gggca ugg gu    c
       ||||||  ||||| ||| | ||| ||||| ||| ||     
3'     cugaug  ggggg cgu g gga cccgu acc ca    u
   cagu      uu     u   c u   c     c   -  gagg 
Get sequence
Deep sequencing
1702 reads, 4.41 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 27713361-27713449 [-]
antisense
ENSBTAT00000003999 ; ACADVL-201; intron 11
Database links

Mature sequence bta-miR-324

Accession MIMAT0009285
Sequence

18 - 

cgcauccccuagggcauuggugu

 - 40

Get sequence
Deep sequencing980 reads, 66 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).