Stem-loop sequence bta-mir-30f

AccessionMI0009795 (change log)
DescriptionBos taurus miR-30f stem-loop
Gene family MIPF0000005; mir-30
Literature search

17 open access papers mention bta-mir-30f
(103 sentences)

Stem-loop
   g     c   uacu       c   aca         -gug a 
5'  agggc aga    guaaaca ccu   cucucagcu    c c
    ||||| |||    ||||||| |||   |||||||||    | a
3'  uuccg ucu    cauuugu gga   gagggucga    g g
   -     -   cucu       c   --a         aaga u 
Get sequence
Deep sequencing
91072 reads, 1.02e+03 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 10781518-10781601 [-]
intergenic
Database links

Mature sequence bta-miR-30f

Accession MIMAT0009282
Sequence

14 - 

uguaaacacccuacacucucagcu

 - 37

Get sequence
Deep sequencing89582 reads, 77 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).