Stem-loop sequence bta-mir-302c

AccessionMI0009794 (change log)
DescriptionBos taurus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

5 open access papers mention bta-mir-302c
(21 sentences)

Stem-loop
       ug  uu             c    -g  u 
5' ccuc  cu  aacauggggguac ugcu  ug a
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 14305374-14305441 [+]
antisense
ENSBTAT00000012693 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from bta-mir-302c
bta-mir-302bchr6: 14305231-14305305 [+]
bta-mir-302cchr6: 14305374-14305441 [+]
bta-mir-302achr6: 14305767-14305836 [+]
bta-mir-302dchr6: 14305944-14306013 [+]
bta-mir-367chr6: 14306070-14306137 [+]
Database links

Mature sequence bta-miR-302c

Accession MIMAT0009281
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence by similarity; MI0010352
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).