Stem-loop sequence bta-mir-302b

AccessionMI0009793 (change log)
DescriptionBos taurus miR-302b stem-loop
Gene family MIPF0000071; mir-302
Literature search

6 open access papers mention bta-mir-302b
(89 sentences)

Stem-loop
   cucc    a   uu       u       u    ga u 
5'     cuuu acu  aacaugg aguacuu cugu  c u
       |||| |||  ||||||| ||||||| ||||  |  
3'     gaag uga  uuguacc ucgugaa gaua  g u
   ---u    a   uu       u       u    aa u 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 14305231-14305305 [+]
antisense
ENSBTAT00000012693 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from bta-mir-302b
bta-mir-302bchr6: 14305231-14305305 [+]
bta-mir-302cchr6: 14305374-14305441 [+]
bta-mir-302achr6: 14305767-14305836 [+]
bta-mir-302dchr6: 14305944-14306013 [+]
bta-mir-367chr6: 14306070-14306137 [+]
Database links

Mature sequence bta-miR-302b

Accession MIMAT0009280
Sequence

49 - 

uaagugcuuccauguuuuaguag

 - 71

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence by similarity; MI0010351
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).