Stem-loop sequence bta-mir-301a

AccessionMI0009789 (change log)
DescriptionBos taurus miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

5 open access papers mention bta-mir-301a
(15 sentences)

Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   -     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
37438 reads, 314 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 10448153-10448237 [-]
sense
ENSBTAT00000028888 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-301a
bta-mir-301achr19: 10448153-10448237 [-]
bta-mir-454chr19: 10438492-10438605 [-]
Database links

Mature sequence bta-miR-301a

Accession MIMAT0009276
Sequence

51 - 

cagugcaauaguauugucaaagcau

 - 75

Get sequence
Deep sequencing37040 reads, 73 experiments
Evidence by similarity; MI0000745
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).