Stem-loop sequence bta-mir-29d

AccessionMI0009788 (change log)
DescriptionBos taurus miR-29d stem-loop
Gene family MIPF0000009; mir-29
Literature search

22 open access papers mention bta-mir-29d
(80 sentences)

Stem-loop
   a         -  ggc   c       ucc       ---     u 
5'  ucucuuaca ca   uga cgauuuc   ugguguu   cagag c
    ||||||||| ||   ||| |||||||   |||||||   ||||| u
3'  gggggaugu gu   auu gcuaaag   accacga   guuuu g
   a         a  ---   a       uuu       ucu     u 
Get sequence
Deep sequencing
160817 reads, 974 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 77816279-77816366 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-29d
bta-mir-29echr16: 77815740-77815820 [+]
bta-mir-29dchr16: 77816279-77816366 [+]
Database links

Mature sequence bta-miR-29d-5p

Accession MIMAT0026919
Sequence

16 - 

ugaccgauuucuccugguguu

 - 36

Get sequence
Deep sequencing507 reads, 70 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence bta-miR-29d-3p

Accession MIMAT0009275
Sequence

54 - 

uagcaccauuugaaaucgauua

 - 75

Get sequence
Deep sequencing160310 reads, 76 experiments
Evidence experimental; cloned [2], Illumina [3]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
3