Stem-loop sequence bta-mir-299

AccessionMI0009787 (change log)
DescriptionBos taurus miR-299 stem-loop
Gene family MIPF0000186; mir-299
Literature search

1 open access papers mention bta-mir-299
(1 sentences)

Stem-loop
        a                      uc 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  a
        c                      ua 
Get sequence
Deep sequencing
2148 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67841943-67842005 [+]
sense
ENSBTAT00000050899 ; bta-mir-299-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-299
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
Database links

Mature sequence bta-miR-299

Accession MIMAT0009274
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Deep sequencing593 reads, 61 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).