Stem-loop sequence bta-mir-296

AccessionMI0009786 (change log)
DescriptionBos taurus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

7 open access papers mention bta-mir-296
(8 sentences)

Stem-loop
   a         c        c  -         g   u    
5'  ggacccuuc ggagggcc cc cccaauccu uug gcu 
    ||||||||| |||||||| || ||||||||| ||| || u
3'  ucugggaag ccuuucgg gg ggguuggga gac ugg 
   -         u        a  c         -   u    
Get sequence
Deep sequencing
5271 reads, 80.9 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 58333114-58333191 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-296
bta-mir-6123chr13: 58332856-58332937 [+]
bta-mir-296chr13: 58333114-58333191 [+]
Database links

Mature sequence bta-miR-296-5p

Accession MIMAT0026918
Sequence

13 - 

gagggccccccccaauccu

 - 31

Get sequence
Deep sequencing561 reads, 64 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence bta-miR-296-3p

Accession MIMAT0009273
Sequence

47 - 

gaggguugggcggaggcuuucc

 - 68

Get sequence
Deep sequencing4709 reads, 67 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2