Stem-loop sequence bta-mir-28

AccessionMI0009785 (change log)
DescriptionBos taurus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

6 open access papers mention bta-mir-28
(7 sentences)

Stem-loop
      c         a        a       u  ----    gcc 
5' ggu cuugcccuc aggagcuc cagucua ug    aguu   u
   ||| ||||||||| |||||||| ||||||| ||    ||||    
3' uca ggacgggag uccucgag guuagau ac    ucag   u
      c         g        a       c  ccuu    ucu 
Get sequence
Deep sequencing
422153 reads, 3.98e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 79540068-79540153 [-]
sense
ENSBTAT00000061134 ; LPP-201; intron 7
Database links

Mature sequence bta-miR-28

Accession MIMAT0009272
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing155145 reads, 77 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).