Stem-loop sequence bta-mir-26a-1

AccessionMI0009784 (change log)
DescriptionBos taurus miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Literature search

41 open access papers mention bta-mir-26a-1
(124 sentences)

Stem-loop
   a     -   g  u   u         c          g gca g 
5'  aggcc gug cc cgu caaguaauc aggauaggcu u   g u
    ||||| ||| || ||| ||||||||| |||||||||| |   |  
3'  uccgg cgc gg gca guucauugg ucuuauccgg g   c c
   g     g   a  c   c         c          g -aa c 
Get sequence
Deep sequencing
2434157 reads, 2.95e+04 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 11513974-11514063 [+]
sense
ENSBTAT00000017828 ; CTDSPL-201; intron 5
Clustered miRNAs
< 10kb from bta-mir-26a-1
bta-mir-26a-1chr22: 11513974-11514063 [+]
bta-mir-26cchr22: 11513974-11514063 [-]
Database links

Mature sequence bta-miR-26a

Accession MIMAT0003516
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Deep sequencing4867811 reads, 78 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).