![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-26a-1 |
||||||
Accession | MI0009784 (change log) | |||||
Description | Bos taurus miR-26a-1 stem-loop | |||||
Gene family | MIPF0000043; mir-26 | |||||
Literature search |
![]()
41 open access papers mention bta-mir-26a-1 | |||||
Stem-loop |
a - g u u c g gca g 5' aggcc gug cc cgu caaguaauc aggauaggcu u g u ||||| ||| || ||| ||||||||| |||||||||| | | 3' uccgg cgc gg gca guucauugg ucuuauccgg g c c g g a c c c g -aa c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-26a |
|
Accession | MIMAT0003516 |
Sequence |
16 - uucaaguaauccaggauaggcu - 37 |
Deep sequencing | 4867811 reads, 78 experiments |
Evidence | experimental; cloned [2-3] |
Predicted targets |
|
References |
|
1 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|
3 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|