Stem-loop sequence bta-mir-224

AccessionMI0009783 (change log)
DescriptionBos taurus miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

13 open access papers mention bta-mir-224
(31 sentences)

Stem-loop
          ca         u   u      a --ua    gu 
5' gggcuuu  agucacuag ggu ccguuu g    gaug  u
   |||||||  ||||||||| ||| |||||| |    ||||   
3' cccgaaa  ucagugauc cca gguaaa c    uuac  g
          ca         -   u      a uuug    au 
Get sequence
Deep sequencing
9675 reads, 22.4 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 34881360-34881440 [-]
sense
ENSBTAT00000065531 ; GABRE-201; intron 6
ENSBTAT00000018017 ; GABRE-202; intron 6
Clustered miRNAs
< 10kb from bta-mir-224
bta-mir-452chrX: 34882394-34882478 [-]
bta-mir-224chrX: 34881360-34881440 [-]
bta-mir-3431chrX: 34879430-34879526 [-]
Database links

Mature sequence bta-miR-224

Accession MIMAT0009271
Sequence

8 - 

caagucacuagugguuccguuua

 - 30

Get sequence
Deep sequencing9629 reads, 67 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).