Stem-loop sequence bta-mir-223

AccessionMI0009782 (change log)
DescriptionBos taurus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

28 open access papers mention bta-mir-223
(96 sentences)

Stem-loop
   ccca  cuccu   -          cc u              gaguug      c a 
5'     gc     gca gugccaugcu  g guauuugacaagcu      gacacu c u
       ||     ||| ||||||||||  | ||||||||||||||      |||||| | g
3'     cg     cgu uacgguguga  c cauaaacuguuuga      cuguga g u
   --ga  --auc   a          ac c              ------      u a 
Get sequence
Deep sequencing
6162 reads, 578 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 101046347-101046454 [-]
intergenic
Database links

Mature sequence bta-miR-223

Accession MIMAT0009270
Sequence

66 - 

ugucaguuugucaaauacccca

 - 87

Get sequence
Deep sequencing6065 reads, 72 experiments
Evidence experimental; Array [3], qRT-PCR [3], cloned [4]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).