Stem-loop sequence bta-mir-217

AccessionMI0009779 (change log)
DescriptionBos taurus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Literature search

3 open access papers mention bta-mir-217
(3 sentences)

Stem-loop
   aauauaauuaacacaga    uu     c c  a  c     c          u -   aag 
5'                  guuu  gaugu g ag ua ugcau aggaacugau g gau   a
                    ||||  ||||| | || || ||||| |||||||||| | |||    
3'                  caaa  cuacg c uc gu acgua uccuugacua c cug   a
   --------------gaa    -u     a u  c  u     c          c a   gcu 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 38641311-38641420 [-]
intergenic
Database links

Mature sequence bta-miR-217

Accession MIMAT0009267
Sequence

35 - 

uacugcaucaggaacugauuggau

 - 58

Get sequence
Deep sequencing31 reads, 11 experiments
Evidence by similarity; MI0000293
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).