Stem-loop sequence bta-mir-216b

AccessionMI0009778 (change log)
DescriptionBos taurus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Literature search

1 open access papers mention bta-mir-216b
(1 sentences)

Stem-loop
   --g       gaa         a  --caaa      g  ac 
5'    cagacug   aaucucugc gg      ugugau uc  u
      |||||||   ||||||||| ||      |||||| ||   
3'    gucugac   uuagagaug cc      acacua ag  a
   aca       auc         c  auucac      a  aa 
Get sequence
Deep sequencing
147 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 38669941-38670022 [-]
sense
ENSBTAT00000042425 ; bta-mir-216b-201; exon 1
Database links

Mature sequence bta-miR-216b

Accession MIMAT0009266
Sequence

11 - 

aaaucucugcaggcaaauguga

 - 32

Get sequence
Deep sequencing105 reads, 31 experiments
Evidence by similarity; MI0005569
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).