Stem-loop sequence bta-mir-216a

AccessionMI0009777 (change log)
DescriptionBos taurus miR-216a stem-loop
Gene family MIPF0000054; mir-216
Literature search

2 open access papers mention bta-mir-216a
(4 sentences)

Stem-loop
   --------------   g   g  ag     u         cu   a      -  --a   u 
5'               gau gcu ug  uuggc uaaucucag  ggc acugug ag   ugu c
                 ||| ||| ||  ||||| |||||||||  ||| |||||| ||   |||  
3'               cua cga ac  aaucg auuaggguc  cug ugacac uc   aca a
   guacucccguuccu   a   g  -a     u         -u   g      c  cug   u 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 38653549-38653657 [-]
intergenic
Database links

Mature sequence bta-miR-216a

Accession MIMAT0009265
Sequence

19 - 

uaaucucagcuggcaacuguga

 - 40

Get sequence
Deep sequencing109 reads, 25 experiments
Evidence by similarity; MI0010344
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).