Stem-loop sequence bta-mir-208b

AccessionMI0009774 (change log)
DescriptionBos taurus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

3 open access papers mention bta-mir-208b
(14 sentences)

Stem-loop
   --c        g          c   cg        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  c
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   gac        g          a   ag        cc 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 21384239-21384315 [+]
sense
ENSBTAT00000051839 ; bta-mir-208b-201; exon 1
ENSBTAT00000061306 ; MYH7-201; intron 29
Database links

Mature sequence bta-miR-208b

Accession MIMAT0009262
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Deep sequencing41 reads, 20 experiments
Evidence by similarity; MI0005552
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).