Stem-loop sequence bta-mir-208a

AccessionMI0009773 (change log)
DescriptionBos taurus miR-208a stem-loop
Gene family MIPF0000178; mir-208
Literature search

2 open access papers mention bta-mir-208a
(3 sentences)

Stem-loop
   u   g           g  c  gg      c  a 
5'  gac ggcgagcuuuu gc cg  uuauac ug u
    ||| ||||||||||| || ||  |||||| || g
3'  cug uuguucgaaaa cg gc  aauaug ac c
   a   g           a  a  ag      c  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 21413140-21413210 [+]
sense
ENSBTAT00000042242 ; bta-mir-208a-201; exon 1
ENSBTAT00000007359 ; MYH7-201; intron 28
Database links

Mature sequence bta-miR-208a

Accession MIMAT0009261
Sequence

44 - 

auaagacgagcaaaaagcuugu

 - 65

Get sequence
Evidence by similarity; MI0000251
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).