Stem-loop sequence bta-mir-199a-2

AccessionMI0009770 (change log)
DescriptionBos taurus miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

24 open access papers mention bta-mir-199a-2
(77 sentences)

Stem-loop
      aac       u        c   ------     g 
5' gcc   ccagugu cagacuac ugu      ucagg g
   |||   ||||||| |||||||| |||      |||||  
3' cgg   gguuaca gucugaug aca      agucu g
      auu       c        -   ugugua     c 
Get sequence
Deep sequencing
416214 reads, 3.31e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 16580964-16581034 [-]
sense
ENSBTAT00000042269 ; bta-mir-3604-1-201; exon 1
antisense
ENSBTAT00000036123 ; DNM2-201; intron 13
Clustered miRNAs
< 10kb from bta-mir-199a-2
bta-mir-199a-2chr7: 16580964-16581034 [-]
bta-mir-3604-1chr7: 16580960-16581037 [+]
Database links

Mature sequence bta-miR-199a-5p

Accession MIMAT0003544
Previous IDsbta-miR-199a
Sequence

6 - 

cccaguguucagacuaccuguu

 - 27

Get sequence
Deep sequencing99439 reads, 64 experiments
Evidence experimental; cloned [1-2]
Predicted targets

Mature sequence bta-miR-199a-3p

Accession MIMAT0003746
Previous IDsbta-miR-199a*
Sequence

47 - 

acaguagucugcacauugguua

 - 68

Get sequence
Deep sequencing733416 reads, 68 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
3
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).