Stem-loop sequence bta-mir-197

AccessionMI0009769 (change log)
DescriptionBos taurus miR-197 stem-loop
Gene family MIPF0000123; mir-197
Literature search

2 open access papers mention bta-mir-197
(4 sentences)

Stem-loop
   --gg    g   c    a       ca    ga   -   a 
5'     ggcu ugc gggu gagaggg  gugg  ggu aag g
       |||| ||| |||| |||||||  ||||  ||| |||  
3'     ccgg acg ccca cucuucc  cacu  cca uuc c
   acga    g   a    c       ac    uc   c   u 
Get sequence
Deep sequencing
10380 reads, 83.1 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 34176846-34176926 [-]
intergenic
Database links

Mature sequence bta-miR-197

Accession MIMAT0009257
Sequence

50 - 

uucaccaccuucuccacccagc

 - 71

Get sequence
Deep sequencing10313 reads, 70 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).