Stem-loop sequence bta-mir-196b

AccessionMI0009768 (change log)
DescriptionBos taurus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

14 open access papers mention bta-mir-196b
(41 sentences)

Stem-loop
   -      uc      uu       u  c           ucca 
5'  aacugg  ggugau  agguagu uc uguuguuggga    c
    ||||||  ||||||  ||||||| || |||||||||||     
3'  uugacu  ucauua  uccguca ag acgacagcucu    c
   g      --      cu       c  c           cuuu 
Get sequence
Deep sequencing
15692 reads, 121 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 69566921-69567005 [+]
intergenic
Database links

Mature sequence bta-miR-196b

Accession MIMAT0009256
Sequence

16 - 

uagguaguuuccuguuguuggga

 - 38

Get sequence
Deep sequencing15464 reads, 57 experiments
Evidence by similarity; MI0001151
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).