Stem-loop sequence bta-mir-196a-1

AccessionMI0009767 (change log)
DescriptionBos taurus miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

21 open access papers mention bta-mir-196a-1
(105 sentences)

Stem-loop
   u  a ugg       ga    a ua   a    c         - gc u  a 
5'  ga c   aacugcu  guga u  ggu guuu auguuguug g  c gg u
    || |   |||||||  |||| |  ||| |||| ||||||||| |  | ||  
3'  cu g   uugacgg  cacu a  cca caaa uacagcaac c  g uc u
   c  c uca       --    c gc   c    u         a aa -  u 
Get sequence
Deep sequencing
15862 reads, 135 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 38661613-38661714 [+]
intergenic
Database links

Mature sequence bta-miR-196a

Accession MIMAT0009255
Sequence

24 - 

uagguaguuucauguuguuggg

 - 45

Get sequence
Deep sequencing29744 reads, 57 experiments
Evidence by similarity; MI0010360
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).