Stem-loop sequence bta-mir-196a-2

AccessionMI0009766 (change log)
DescriptionBos taurus miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

21 open access papers mention bta-mir-196a-2
(105 sentences)

Stem-loop
   a     uc                  a          a ug   
5'  gcuga  uguggcuuagguaguuuc uguuguuggg u  ag 
    |||||  |||||||||||||||||| |||||||||| |  | u
3'  ugacu  acauugaguccgucaaag acaacggcuc a  uu 
   c     --                  a          a gu   
Get sequence
Deep sequencing
15164 reads, 123 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 26246499-26246583 [-]
intergenic
Database links

Mature sequence bta-miR-196a

Accession MIMAT0009255
Sequence

16 - 

uagguaguuucauguuguuggg

 - 37

Get sequence
Deep sequencing29744 reads, 57 experiments
Evidence by similarity; MI0010360
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).