Stem-loop sequence bta-mir-194-2

AccessionMI0009765 (change log)
Previous IDsbta-mir-194
DescriptionBos taurus miR-194 stem-loop
Gene family MIPF0000055; mir-194
Literature search

6 open access papers mention bta-mir-194-2
(11 sentences)

Stem-loop
   u            cu         a      g     g  c 
5'  ggcucccacccc  guaacagca cuccau uggaa ua c
    ||||||||||||  ||||||||| |||||| ||||| ||  
3'  ccgggggugggg  uauugucgu ggggug accuu au u
   a            uc         c      -     g  c 
Get sequence
Deep sequencing
794530 reads, 5.95e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 44018295-44018377 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-194-2
bta-mir-194-2chr29: 44018295-44018377 [+]
bta-mir-194b-2chr29: 44018309-44018361 [-]
bta-mir-192chr29: 44018495-44018600 [+]
Database links

Mature sequence bta-miR-194

Accession MIMAT0009254
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing1592283 reads, 76 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).