Stem-loop sequence bta-mir-193b

AccessionMI0009764 (change log)
DescriptionBos taurus miR-193b stem-loop
Gene family MIPF0000082; mir-193
Literature search

5 open access papers mention bta-mir-193b
(6 sentences)

Stem-loop
      gu       u    gu    a    g  a  ag uua 
5' gug  cccagaa cggg  uuug gggc ag ug  u   u
   |||  ||||||| ||||  |||| |||| || ||  |   g
3' uac  ggguuuu gccc  aaac cccg uc ac  a   u
      ug       c    ug    a    g  a  cu uuu 
Get sequence
Deep sequencing
16585 reads, 78.8 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 13397029-13397111 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-193b
bta-mir-193bchr25: 13397029-13397111 [+]
bta-mir-365-1chr25: 13401780-13401866 [+]
Database links

Mature sequence bta-miR-193b

Accession MIMAT0009253
Sequence

51 - 

aacuggcccacaaagucccgcuuu

 - 74

Get sequence
Deep sequencing13792 reads, 66 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).